This allele from project Ccdc78-6895J-M2468 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, GATCCTTCTTTAGGGGATGA, CAGGACAACTGGTCAGCAAC and CTTGGGTACTCCCAGGTGCT, which resulted in a 205 bp deletion beginning in intron 6 at Chromosome 17 positive strand position 25,787,901 bp, beginning at GGATGACGGATGACCTCACCC, and ending after AAACAGAGCAATCGCCTCTTG at position 25,788,105 bp in intron 7 (GRCm38). This mutation deletes exon 6 and is predicted to cause amino acid sequence changes after residue 167 and early truncation 22 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count