Rab11fip4^em1(IMPC)J

This allele from project Rab11fip4-6842J-M9341 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CGTCTACAAGTGCGTCTGCA, ATGACATTGGCCCTACCTGA and ACGGGTACTTTCTAGCTCCG, which resulted in a 405bp deletion beginning in intron 4 at CGTGACTCAGCCACCATGAGAG at Chromosome 11 positive strand position 79,680,652 bp (GRCm38) and ending after TTTCTAGCTCCGGGGCCACATGCC at position 79,681,056 bp in intron 5. This mutation deletes exon 4 and is predicted to cause amino acid sequence changes after residue 112 and early truncation 28 amino acids later. (J:188991)