Olfml2b^em1(IMPC)J

This allele from project Olfml2b-6834J-F3656 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, ATACAGTCGCACTTCCCAAG, AATCACCTACTATAAAGCCA and GGGATTTCATCCTTAGTGCA which resulted in a 390bp deletion beginning in intron 5 at GGCCCTCTTGGGAAGTGCGACTGTAT at Chromosome 1 positive strand position 170,666,451 bp (GRCm38) and ending after TCAGGGATTTCATCCTTAGTGCAG at position 170,666,840 bp in intron 6. This mutation deletes exon 5 and is predicted to cause amino acid sequence changes after residue 241 and early truncation 13 amino acids later. (J:188991)