This allele from project Tmco1-6660J-M1122 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, ATAAGACGAAGTGAATATGT and CAACAATAGAGACCTGTCAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 281bp deletion beginning in intron 3 at TATTCACTTCGTCTTATTGA at Chromosome 1 positive strand position 167,316,119 bp (GRCm38) and ending after AGTTCTTAAAATGTATTACCT at position 167,316,399 bp in intron 4. This mutation deletes exon 4 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count