This allele from project Trip13-6637J-2781F was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CACTAAAGTATAGCTAGGTC, TTGTGTTTGGAGATTACGTC and CGGGTTACTACCCTATCTGT which resulted in a 556bp deletion beginning in intron 1 at CTAGCTATACTTTAGTGGG at Chromosome 13 negative strand position 73,936,559 bp (GRCm38) and ending after TAGCGGGTTACTACCCTATC at position 73,936,004 bp in intron 2. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 31 and early truncation 3 amino acids later. (J:188991)