This allele from project Ubn1-6239J-105P8MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ACGTAGGAAAGACCGAATAC which resulted in a 7 bp deletion ACCGAAT in exon 5 beginning at Chromosome 16 positive strand position 5,062,557 - 5,062,563 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 121 and early truncation 1 amino acid later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count