This allele from project Myom1-6238J-102P4ML was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCGTGCGAAGGTCCTTGTTC, which resulted in a 37 bp deletion CCATCAGCACTATGATCTCAGTTACCGGAACAAGGAC in exon2 beginning at chromosome 17 positive strand position 71022901-71022937 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 9 and early truncation 4 amino acid residues later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count