This allele from project Serpina7-6133J-FP4L was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences GTCATTTGCCCCAACAAAAT and ATACAGACTGAATGCAAAGT which resulted in a 7 bp deletion ATTTGCC in exon2 beginning at Chromosome X negative strand position 139,083,601 - 139,083,595 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 41 and early truncation 31 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count