Fastkd5^em1(IMPC)J

This allele from project Fastkd5-6053J-P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GTGGTATGCCGAAGATTTAC, which resulted in a 14 bp deletion TGCCGAAGATTTAC in exon2 beginning at Chromosome 2 negative strand position 130,616,640 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 21 amino acids later. (J:188991)