Ncoa6^em1(IMPC)J

This allele from project Ncoa6-6076J-P6MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ATCTACAATGGGCGACTCAG, which resulted in an 11 bp deletion GGCGACTCAGA in exon2 beginning at Chromosome 2 negative strand position 155,437,978 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 22 and early truncation 2 amino acids later. (J:188991)