The 27 nucleotide -3.9 site (AGATAGGAAAATGGCCGCGCGCTATCT) containing inverted WGATAR motifs was replaced with a loxP site flanked neomycin resistance gene cassette. The neo cassette was removed through subsequent cre-mediated recombination. Expression levels of Gata2 mRNA in Lin- progenitors, Ter119+ erythroid cells and the fetal liver and brain are indistinguishable from that in wild-type mice. (J:207377)