Plk5^em1(IMPC)J

This allele from project Plk5-5922J-4194 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CGAGCCTGGGTCGCGCAGGA, which resulted in a 1 bp deletion G in exon 1 beginning at Chromosome 10 positive strand position 80356646 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 28 and an early truncation 3 amino acids later. (J:188991)