This allele from project Zfyve26-5939J-1816 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GGAGGACATACTACAGGCGC, which resulted in an 11 bp deletion ATACTACAGGC in exon 2 beginning at Chromosome 12 negative strand position 79295514 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 52 and an early truncation 57 amino acids later. (J:188991)