The hairpin loopwas eliminated and several additional nucleotides were introduced to create a new Pst I restriction site. The original sequence was acaattaacattcattgttgtcggtgggttg and the new sequence was acaattaagtgctaatgttgtccctgcagtgtg. A floxed neo selection cassette was subsequently removed by cre excision. Northern blot analhysis confirmed the lack of mature transcript without effecting expression of Mir181c. (J:94077, J:212571)