This allele from project Exoc4-5677J-3730 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ACCGAGATGAGCAGCCCCGA, which resulted in a 10 bp deletion GGGGCTGCTC beginning at Chromosome 6 positive strand 33249215 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count