This allele from project Fxn-5659J-106A was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AGTAGCATGTGGGCGTTCGG, which resulted in a 4 bp deletion TTCG in exon 1 beginning at Chromosome 19 negative strand position 24,280,560 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count