This allele from project Adad2-5594J-B was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCCATGCTCAGCGGTCCTAG, which resulted in an 8 bp deletion CTAGGACC and a 4 bp insertion ATGA in exon1 beginning at Chromosome 8 positive strand position 119612902 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)