Tyr^em3J

This zinc finger mediated allele was generated at The Jackson Laboratory and is a 24 bp deletion of AGGGACCACTATTACGTAATCCTG from Chromosome 7 negative strand position 87,483,953 bp through 87,483,976 bp (GRCm38/mm10), which results in a recessive albino phenotype. This is predicted to cause an 8 amino acid in-frame deletion of amino acids 295-302, GPLLRNPG, near the center of the di-copper centre-containing domain, but is not predicted to cause a premature truncation or frameshift. (J:208906)