Recombinase-mediated cassette exchange (RMCE) replaced the expression cassette between the JT15 and lox2272 sites of Gt(ROSA)26Sortm1Maoh with (5' to 3') an IRES, lacZ, polyadenylation sequence, CAG promoter, hygro gene, polyadenylation sequence, FRT site, polyadenylation sequence, and CAG driven fusion of EGFP and a short hairpin RNA targeted to Tyrosinase. The RNAi target sequences within the Tyr gene are "ctggaaggatttgccagtccac"and "gaactgccaatttcagcttta". Flp-mediated recombination removes all but the CAG promoter RNAi construct flanked by an FRT site and the lox2272 site. (J:173808)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count